Mutation lacZ4822
- Name: lacZ4822
- Type: Compound Allele
- Mutation of Gene: lacZ
- Approx. Map Location: 7.18
- Synonyms
Designation Where Used lacZ(QP6) Seier et al., 2011 - Comments
- is a compound allele replacing TTTG-C--CTGGT-TTCCGGCACCAGAA with TTTGCCAGCTTCTCTTCCGGCACCGGAA starting at base 181 in the lacZ sequence. This results in a frameshift mutation and the formation of a quasipalendrome.
- References
- 2 Strains Carrying This Mutation
Name Mutations Genotype STL15654 4 F-, lacZ4822, mhpC281::Tn10, λ-, rph-1 STL15655 5 F-, lacZ4822, mhpC281::Tn10, λ-, ΔmutS738::kan, rph-1