CGSC Strain#: 7305
Strain Designation: GW2707      Source of Strain: G.C. Walker
Sex: F- Episome/Plasmid: pGW600
   Plasmid Markers/Mutations:
   Plasmid Comment: overproduces temperature resistant Mu repressor and thus lowers levels of spontaneous transposition and deletion formation of Mu d(Ap lac). pMB9 (tetR) + Mu repressor(tempR)
Chromosomal Markers: thr-1, araC14, leuB6(Am), Δ(argF-lac)169, tsx-33, glnX44(AS), galK2(Oc), λ^-, sulA211, hisG4(Oc), recA441(ts), rpsL31(strR), xylA5, dinD1::Mud(Ap,lac), argE3(Oc), thiE1, lexA71::Tn5, ilv(ts)
Strain Comments:

• leuB6(Am)-- Suppressed by serU suppressor (supH)
• Δ(argF-lac)169-- extends from mmuP through orfs preceding argF, through lac to mhpD, literally Δ(mmuP-mhpD)169. (Peters et al. 2003 JB 185:2017)
• Δ(argF-lac)169-- from strain Hfr3000 U169 was initially called ΔlacU169 and described as a lacZY mutation until found to include argF and lacI.
• glnX44(AS)-- Mutation is a C to T transition at nucleotide 34 (3rd position of the anticodon)
• galK2(Oc)-- is a GAA(glu) to TAA(ochre) mutation, residue 134. Oller et al.1993. Apparently non-suppressible, since all revertants found were at the ochre site.
• sulA211-- was formerly called sfiA11.
• sulA211-- This allele is the result of a T>C change in the -10 promoter (TACTGT -> TACTGC), which also overlaps with the LexA-binding site (TACTGTACATCCATACAGTA -> TACTGCACATCCATACAGTA)
• recA441(ts)-- formerly tif-1 (temp.-induced filamentation). Not a Rec^- phenotype, "constitutive protease activity" not requiring ss-DNA binding at hi temp.
• dinD1::Mud(Ap,lac)-- promoterless lacZ fused with dinD1 promoter in a defective Mu phage, construct also AmpR, integrated into the chromosome
• ilv(ts)-- = relA?
• galK2(Oc) was formerly called gal₂
• glnX44(AS) was formerly called su⁺_II
• glnX44(AS) was formerly called supE44
• glnX44(AS) was formerly called glnV44
• thiE1 was formerly called thi-1
• = kanamycin resistant
• Am = amber(UAG) mutation
• AS = amber(UAG) suppressor
• Oc = ochre(UAA) mutation
• strR = streptomycin resist.
• ts = Temperature Sensitive

References:

• Krueger, J.H., S.J. Elledge, G.C. Walker 1983. Isolation and characterization of Tn5 insertion mutations in the lexA gene of Escherichia coli. J.Bacteriol. 153:1368-1378